Saturday, October 1, 2022
HomeBiotechnologyPreclinical evaluation of antigen-specific chimeric antigen receptor regulatory T cells to be...

Preclinical evaluation of antigen-specific chimeric antigen receptor regulatory T cells to be used in strong organ transplantation

Facebook
Twitter
Pinterest
WhatsApp

Ethics approval

All animal experiments had been carried out in accordance with related tips and laws, both in an permitted animal facility at Sangamo Therapeutics France (accredited by the French Ministry of Analysis, Arrêté n° 4566) in keeping with the APAFIS (“Autorisation de Projet utilisant des Animaux à des Fins Scientifiques”)-approved protocol APAFIS#12909-2017121211476703 v4 and in compliance with the Information for the Care and Use of Laboratory Animals, or on the College of British Columbia (UBC), permitted by the UBC Animal Care Committee (A16-0300).

Experiments utilizing human samples had been carried out in accordance with the Declaration of Helsinki and permitted by applicable ethics committees. Leukopaks for Treg isolation had been sourced from HemaCare (Northridge, USA), an FDA-registered assortment heart, from wholesome human volunteers who consented beneath an Institutional Evaluate Board-approved protocol compliant with Code of Federal Rules Title 21 Half 1271. Allogeneic T cells and peripheral blood mononuclear cells (PBMCs) had been obtained from wholesome donors following written consent in keeping with protocols permitted by the Etablissement Français du sang. Human pores and skin discarded from cosmetic surgery was obtained from the Harvard Pores and skin Useful resource Centre, Pores and skin Works, or the Cambie Surgical procedure Clinic in keeping with protocols permitted by the UBC Scientific Analysis Ethics Board (H16-02930).

Technology and propagation of Tregs with HLA-A*02-specific CAR

The humanized HLA-A*02 ScFv was fused to a transmembrane area and a signaling area composed of the intracellular area of human CD28 and CD3ζ. The management CAR TX235 was composed of the humanized HLA-A*02 ScFv and transmembrane area however lacked intracellular signaling domains CD28 and CD3ζ. The ensuing cDNA was cloned right into a lentiviral vector. The TX200 lentivirus was produced by Lentigen/Miltenyi (Gaithersburg, USA). The TX235 lentivirus was generated in home by transfecting adherent HEK293T cells (Lenti-X) with a lentiviral 4-plasmid system together with human immunodeficiency virus kind 1 (HIV-1) gagpol, HIV-1 Rev, envVSV-G, and the TX235 CAR switch plasmid. A schematic of TX200 and TX235 is offered within the supplementary information (Fig. S1). Floor expression was decided by circulate cytometry utilizing fluorescent HLA-A*02 dextramer (#WB2666, Immudex, Denmark).

White blood cells had been harvested from wholesome HLA-A*02-negative donors utilizing leukapheresis and had been cryopreserved (HemaCare). The leukapheresate was thawed and cells had been remoted after staining for CD4 (PE-Vio770, #130-093-142), CD45RA (FITC, #170-076-502), CD25 (PE, #170-076-505) and CD127 (APC, #170-076-501) with antibodies that had been of Good Manufacturing Follow-grade, besides CD4 PE-Vio770, (all Miltenyi Biotech) to isolate naïve Tregs outlined as CD4+/CD45RA+/CD25excessive/CD127low utilizing an SH800 cell sorter (Sony, Japan). The gating technique is proven within the supplementary information (Fig. S2). Cells had been then resuspended in X-VIVO-15 medium (#BEBP02-054Q, Lonza) with 1000 U/ml interleukin (IL)-2 (#2238131-A, Novartis Pharma) and activated with anti-CD3/CD28-coated dynabeads (#40203D, Life Applied sciences). After 72 h, cells had been transduced with the lentiviral vector and additional expanded in X-Vivo-15 medium with 1000 U/ml IL-2 and anti-CD3/CD28-coated dynabeads. Medium was refreshed with IL-2 each 2 days. Cells had been expanded for lower than 2 weeks to maintain the cells in an exponential part of progress and reduce lack of the naïve Treg phenotype. At harvesting, magnetic beads had been eliminated with the CTS™ DynaMag system (#12102, ThermoFisher, France) and cells had been washed and cryopreserved in AT2 vials (AT-Closed Vial®, Aseptic Applied sciences, Belgium) in CryoStor CS10 (#210102, BioLife Options, USA). Vials had been saved at −150 °C in a dry freezer till additional use. After lentiviral transduction and growth, cells had been 100% CD4+/CD45RA+, 99.8 ± 0.10% CD25+, 97.8 ± 0.59% CD127low, and 93.6 ± 1.26% FOXP3+ (imply ± SEM with n = 16), with FOXP3 TSDR hypomethylation of 89.1 ± 3.4% after thawing. Cells had been viable at 86.9 ± 1.3% and transduced with the HLA-A*02 CAR at 54.7 ± 1.8% (imply ± SEM, n = 20). Of be aware, an integration web site evaluation indicated polyclonal insertion of the lentiviral vector and no surprising integration or web site selectivity had been discovered (information not proven).

Circulation cytometry

Cells from in vitro experiments had been washed with phosphate-buffered saline (PBS)/4% bovine serum albumin and stained for cell floor markers together with HLA-A*02 dextramer (#WB2666-APC, Immudex, Denmark), anti-human CD4, and anti-human CD69 (VioBlue, #130-113-219 and APC-Vio770, #130-112-616, Miltenyi Biotech, France). Previous to in vivo experiments, the variety of HLA-A*02 CAR-expressing cells within the Treg batch used was decided utilizing HLA-A*02 dextramer (#WB2666-PE, Immudex, Denmark).

Following in vivo experiments, spleen and mind samples had been handed by way of a 70-µm cell strainer to acquire a single cell suspension. Mind cells had been then incubated in RPMI/5% fetal calf serum (FCS) with 2.5 mg/ml collagenase D (#11088858001, Sigma–Aldrich, France) at 37 °C beneath agitation, washed in RPMI/5% FCS, and centrifuged. The cell pellet was resuspended in 70% (v/v) Percoll resolution (#GE17-0891-01, Sigma–Aldrich, France), centrifuged at 500 × g over 37% (v/v) Percoll, and cells on the interface of the Percoll 70/37 gradient had been recovered. Different tissues had been roughly chopped with a scalpel blade and digested in RPMI/5% FCS containing 150 µg/ml collagenase D and 25 µg/ml DNase I (#10104159001, Sigma–Aldrich, France) and handed by way of a cell strainer. Purple blood cells in blood samples and tissues had been lysed with Purple Blood Cell Lysing Buffer (#R7757, Sigma–Aldrich, France) or ammonium chloride. Blood and tissue cells had been washed with PBS/2% FCS and incubated with mouse Fc block (#553142, BD Biosciences, France). Cells had been then washed with PBS/4% bovine serum albumin and stained. Fixable viability dyes eFluor780 or eFluor506 (#65-0865-14 and #65-0866-14, ThermoFisher, France) had been used. Cells had been stained first with anti-human HLA-A*02 (BV421, #740082 or PE, #558570, BD Biosciences, France) and different cell floor markers, together with anti-human CD4 (PE-Cy7, #557852 or FITC, #555346, BD Biosciences, France; or Percp-Cy5.5, #45-0049-42, ThermoFisher, France) and anti-human CD45 (VioGreen, #130-110-638, Miltenyi Biotech, France), after which fastened and permeabilized with the forkhead field P3 (FOXP3) staining buffer set (#00-5523-00, ThermoFisher, France), and stained for intracellular markers, together with anti-human FOXP3 (PE, #12-4777-42, ThermoFisher, France or Alexa Fluor 647, #560045, BD Biosciences, France). Additional antibody particulars are supplied within the supplementary strategies.

An Attune™ NxT circulate cytometer and Attune™ NxT software program had been used for in vitro experiments, the biodistribution examine, and tacrolimus examine and analyses had been carried out with FlowJo V10. A MACSQuant Analyzer 10 with MACSQuantify software program 2.8 was used for the GvHD mannequin and hypomethylation examine, and Cytoflex (Beckman Coulter) with FlowJo Software program V9.9.4 and 10.3 was used for the pores and skin transplant experiment. Naïve Tregs had been remoted utilizing an SH800 cell sorter and the gating technique was modified from [17]. Exemplary gating methods are offered within the supplementary strategies (Fig. S2).

FOXP3 hypomethylation

To evaluate FOXP3 Treg-specific demethylated area (TSDR) hypomethylation, genomic DNA was extracted from cell pellets utilizing the DNeasy Blood and tissue equipment (#69506, Qiagen, USA), DNA bisulfite conversion was executed utilizing the Epitech Quick Bisulfite Conversion Equipment (#59826, Qiagen, USA), and FOXP3 TSDR hypomethylation was then assessed by qPCR high-resolution melting curve evaluation utilizing Precision Soften Supermix (#1725112, Biorad, France) and FOXP3 TSDR-specific primers (ahead: TTGGGTTAAGTTTGTTGTAGGATAG, reverse: ATCTAAACCCTATTATCACAACCCC, Sigma Aldrich, France). The fragment analyzed included 11 CpG websites and complete TSDR methylation was calculated because the imply of methylation share of every particular person CpG. Methylation ranges had been decided utilizing a normal curve (#59695, Qiagen). For CAR-Treg merchandise manufactured from leukapheresates of feminine donors, uncooked values had been corrected to think about that one of many two TSDR alleles is totally methylated on account of X-inactivation.

Plasma cytokine evaluation

Human cytokines in plasma (interferon-γ [IFNγ], IL-1β, IL-2, IL-6, IL-10, IL-12p70, IL-13, IL-17A/F) had been measured utilizing multiplex cytokine immunoassay plates (V-plex customized human biomarker proinflammatory panel, #30098491, MesoScaleDiscovery, USA) in keeping with producer’s directions.

In vitro assays

For in vitro experiments, every Treg donor constituted a person experiment and n represents the variety of Treg donors. Per experiment, 3 to 4 totally different Treg batches had been used (see determine legends for variety of organic and technical replicates). Mycoplasma testing was carried out for all remoted cells as a part of the standard assessments.

For activation, suppression, and cross-reactivity assays, TX200-TR101 Tregs had been first cultured at 37 °C in X-VIVO-15 medium (#BEBP02-054Q, Lonza) with 300 IU/ml IL-2 (#2238131-A, Novartis Pharma) for 48 h.

Within the activation assay, TX200-TR101 Tregs had been stimulated for twenty-four h with anti-CD3/CD28-coated dynabeads (#40203D, Life Applied sciences, 1 bead:1 cell ratio) as a optimistic management for optimum TCR activation, with HLA-A*02-positive PBMCs (1:1 ratio of PBMCs to Tregs), with HLA-A*02 dextramer (#WB2666-PE, Immudex, Denmark), or with HLA-A*02-negative PBMCs (1:1 ratio of PBMCs to Tregs) or clean dextramer (#NI3233, Immudex, Denmark) as adverse controls. Cells had been then harvested and analyzed by circulate cytometry.

Within the suppression assay, Tconv had been stained with a fluorescent proliferation dye (eFluor450, #65-0842-85, ThermoFisher, France). TX200-TR101 Tregs had been cultured with out IL-2 for twenty-four h and preactivated with HLA-A*02 or clean dextramer for twenty-four h whereas allogeneic CD4+/CD25 Tconv had been preactivated for twenty-four h with anti-CD3/CD28-coated dynabeads (1:1 ratio). Preactivated Tconv and allogeneic TX200-TR101 Tregs had been then co-cultured at Tconv:Treg ratios of 1:1, 2:1, 4:1, 8:1, 16:1 or 1:0 for 3 days at 37 °C in X-VIVO-15 medium. Proliferation suppression of Tconv was assessed by circulate cytometry. The share of suppression was calculated for every ratio Tconv:Treg as the share of inhibition of the Tconv proliferation when cultured with Tregs in contrast with Tconv cultured alone.

Within the cross-reactivity assay, TX200-TR101 Tregs had been co-cultured with characterised cryopreserved human PBMCs (#CTL-UP1, Mobile Know-how Restricted) in a 1:1 ratio for twenty-four h. The HLA genotypes of the PBMCs that had been out there within the biobank for testing are specified within the supplementary. Cells had been then harvested and analyzed by circulate cytometry.

To evaluate the chance of mobile transformation and acquisition of a tumorigenic potential, TX200-TR101 Tregs cultured in X-VIVO-15 medium with 300 IU/ml IL-2 for twenty-four h had been left unstimulated or chronically stimulated with anti-CD3/CD28-coated dynabeads (1:1 ratio) within the presence or absence of high-dose IL-2 (1000 IU/ml) for as much as 75 days. Enlargement with chronical stimulation was carried out each 7 days and sub-passage each 2 days till cell loss of life. From the third spherical of activation with beads, and/or relying on the cell progress, beads had been changed each 7 days. Three days after activation, cells had been counted and diluted with recent medium. This medium refresh was carried out each 2 days, based mostly on cell counting. In tradition circumstances the place viability reached <3–5%, cells had been stored in tradition for an extra 15 days, with a medium refresh each 2–3 days, to make sure no clone of immortalized cells would develop. For cells cultured with high-dose IL-2, a number of hunger cycles had been carried out to make sure that no IL-2-independent cell progress occurred. Weekly, 2 samples of 1–0.5 × 106 cells had been frozen in 10% dimethyl sulfoxide and despatched to Life Size® (Madrid, Spain) for evaluation of telomere size utilizing excessive throughput quantitative fluorescent in situ hybridization know-how [18] and of telomerase exercise utilizing a telomerase repeat exercise protocol modified for real-time qPCR evaluation [19]. Every assay analyzed 5 technical replicates.

Mouse fashions

NOD scid gamma (NSG) mice (NOD.Cg-Prkdcscid Il2rgtmWjl /SzJ, JAX inventory no 005557) [20] and HLA-A*02 NSG mice with humanized HLA-A*02 (NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg[HLA-A/H2-D/B2M]1Dvs/SzJ, JAX inventory no 014570) [21] had been bought from Jackson Laboratory (Bar Harbor, USA), distributed by Charles River (Lyon, France) or bred in home on the UBC. Until in any other case specified, mice had been housed in a particular opportunistic pathogen-free facility, in individually, positively ventilated polysulfone cages with HEPA-filtered air, managed 12 h gentle/darkish cycle, temperature of 20–26 °C, and relative humidity of 30–70%. Filtered faucet water and normal rodent chow had been supplied advert libitum. For experiments, mice had been age-matched however distributed randomly to therapy teams. Apart from the pores and skin graft experiment that was performed with two Treg batches, every in vivo experiment was performed with one Treg batch/donor and n represents the variety of mice per group.

Until in any other case specified, mice had been conditioned with intraperitoneal injection of 30 mg/kg busulfan (#B2635, Sigma–Aldrich) to favor human cell engraftment roughly 24 h previous to intravenous human cell injection by way of the tail vein. The variety of cells for injection was decided for every batch of Tregs by circulate cytometric evaluation of HLA-A*02 CAR-expressing cells utilizing dextramer. The share of dextramer-positive cells ranged from 45–72% and the variety of Tregs injected ranged from 2.5–5 × 106 cells per mouse within the particular person experiments. FOXP3 hypomethylation ranges had been additionally assessed previous to cell injection. All through experiments, physique weights and GvHD scores had been monitored 3 instances weekly by investigators that had been blinded to therapy. GvHD was scored based mostly on weight, fur texture, posture, exercise degree, and pores and skin integrity. Until in any other case specified, classes had been rated from 0–3 as described within the supplementary (Desk S2), with larger scores indicating extra signs. Throughout experiments, blood samples had been collected by retro-orbital sampling beneath native anesthesia (except specified in any other case beneath). On the finish of experiments or when moral endpoints had been reached, mice had been euthanized by cervical dislocation, necropsy was carried out, and tissue and blood samples had been collected.

Within the GvHD experiment, a complete of 30 feminine NSG mice aged 7–8 weeks and with a median (vary) weight of twenty-two g (20–25 g) had been randomly assigned to one of many 3 following teams: HLA-A*02-positive human PBMCs alone, along with TX200-TR101 Tregs, or with TX235-TR101 Tregs (n = 5 per group/2 pooled experiments). Mice had been conditioned with busulfan, injected with HLA-A*02-positive human PBMCs and/or Tregs (1:1 ratio, 5 × 106 cells every), and monitored as described above for 4 weeks. Blood samples for circulate cytometry had been collected weekly and blood and spleen had been collected at sacrifice. Consultant fluorescence-activated cell sorting (FACS) plots obtained in blood are proven within the supplementary information (Fig. S3).

Within the hypomethylation experiment, a complete of 11 female and male HLA-A*02 NSG mice aged 8–11 weeks and with a median (vary) weight of 29 g (23–36 g) had been randomly assigned to one of many 3 following teams in keeping with the diploma of FOXP3 TSDR hypomethylation of the injected TX200-TR101 Tregs: 80.8% hypomethylation (n = 5, 3 males and a couple of females), 92% (n = 3, 1 male and a couple of females), and 89.1% (n = 3, 2 males and 1 feminine). Mice had been conditioned with busulfan, injected with TX200-TR101 Tregs (2.5 × 106 cells per mouse), and monitored as described above for 27 days. Blood samples for circulate cytometry had been collected weekly and blood, spleen, liver, and lung had been collected at sacrifice. The outcomes of those experiments are offered along with outcomes of earlier experiments with an identical set-up, the place Tregs remoted with a earlier gating technique (TR100) had been included. In these experiments, female and male HLA-A*02 NSG mice aged 8–11 weeks acquired TX200-TR100 Tregs with 69% hypomethylation (n = 20, 9 males and 11 females), or TX200-TR101 Tregs with 100% hypomethylation (n = 5, 2 males and three females) or 98% hypomethylation (n = 2, 1 male and 1 feminine), and had been monitored for as much as 27 days.

Within the biodistribution experiment, a complete of 24 female and male HLA-A*02 NSG mice aged 8-10 weeks and with a median (vary) weight of 24 g (20–31 g) had been conditioned with busulfan, injected with TX200-TR101 Tregs (3 × 106 cells per mouse), and monitored as described above. Mice had been randomly assigned to certainly one of 3 sacrifice timepoints at 1, 2, and three months (n = 8, 3 males and 5 females, deliberate per timepoint). Blood samples for circulate cytometry had been collected weekly and blood (for circulate cytometry and plasma cytokine evaluation), spleen, liver, lung, kidney, coronary heart, testis/ovaries, mind, and gut had been collected at sacrifice. Gross pathology and histopathology had been carried out. For animals euthanized 2 and three months post-injection, components of the spleen, lung, kidney, liver, testis/ovary, mind, and the entire gut had been collected for histopathology. Any gross lesion/irregular tissue progress through the examine was collected with half the lesion analyzed by circulate cytometry and half fastened in 10% buffered formalin for histological evaluation. The remainder of the spleen, liver, lung, kidney, coronary heart, mind, and testis/ovaries had been processed for circulate cytometric evaluation. The gating technique is proven within the supplemental information (Fig. S4).

Within the tacrolimus experiment, a complete of 20 feminine NSG mice aged 7 weeks and with a median (vary) weight of 21 g (17–25 g) had been randomly assigned to one of many 4 following therapy teams: PBMCs solely (n = 7), PBMCs plus tacrolimus (n = 6), TX200-TR101 Tregs (n = 3), and TX200-TR101 Tregs plus tacrolimus (n = 4). Mice had been conditioned with busulfan and injected with PBMCs and/or Tregs (5 × 106 cells every), as described above and tacrolimus teams acquired day by day intraperitoneal injections of 0.5 mg/kg tacrolimus (Prograf, #29485063, Astellas Pharma, by way of Euromedex, France) for 3 weeks, beginning 7 days after cell injection. The tacrolimus dose was chosen based mostly on the outcomes of pilot research, the place doses between 0.1 and a couple of mg/kg had been examined. Mice had been monitored as described above for a complete length of three weeks. Spleen was collected at sacrifice.

Within the pores and skin transplant experiment, a complete of 32 feminine NSG mice aged 8–12 weeks and with a median (vary) weight of twenty-two g (20–25 g) acquired dorsal pores and skin transplants of roughly 1 cm2 from human HLA-A*02-positive donors as described beforehand [8]. Nineteen mice acquired a graft from Donor 1 (Cohort 1) and 13 mice acquired a graft from Donor 2 (Cohort 2). 9 weeks after pores and skin transplantation, mice had been randomly assigned to one of many 4 following teams: PBS (n = 3 every for Cohorts 1 and a couple of), HLA-A*02-negative human PBMCs (n = 6 for Cohort 1, n = 3 for Cohort 2), HLA-A*02-negative human PBMCs plus autologous TX200-TR101 Tregs (n = 7 for Cohort 1, n = 5 for Cohort 2), and TX200-TR101 Tregs alone (n = 3 for Cohort 1, n = 2 for Cohort 2) and injected with 10 × 106 PBMCs and/or 5 × 106 Tregs (2:1 ratio). Every cohort acquired a special batch of TX200-TR101 (Donors 1 and a couple of). Human PBMC engraftment and pores and skin rejection had been analyzed and blood samples for circulate cytometry collected weekly. GvHD rating classes on this experiment had been rated from 0–2 as described in Cooke et al. 1996 [22] and blood samples had been collected from the saphenous vein. The mice had been monitored for 28 to 35 days, and pores and skin graft, surrounding mouse pores and skin, spleen, gut, liver, and lung had been harvested for histopathology at sacrifice. GvHD and pores and skin rejection scores of each cohorts had been pooled for evaluation.

Histology and immunohistochemistry

Human pores and skin grafts and surrounding mouse pores and skin had been fastened in a single day at 4 °C in 10% formalin and saved in 70% ethanol earlier than paraffin-embedding and preparation of hematoxylin/eosin-stained sections. For histopathological pores and skin graft scoring, slides had been evaluated by a blinded medical pathologist utilizing a scoring system outlined by 6 components (Lerner grade, spongiosis, necrotic keratinocytes, adnexal involvement, parakeratosis, lymphoid cuffs in dermis) as described beforehand [8]. Tissues collected within the biodistribution examine had been fastened in 10% buffered formalin and shipped to Vetopath (Antibes, France) for histological evaluation. Tissues had been dehydrated in Tissue Tek VIP2000 (Miles Scientific) and embedded in resin-mixed paraffin after xylene baths. Tissues collected on the UBC had been shipped to Pacific Tox Path, LLC (USA) for analysis, the place tissues had been trimmed and processed to paraffin blocks. All tissue blocks had been lower at 4–5 µm and sections stained with hematoxylin/eosin and examined microscopically by a board-certified veterinary pathologist.

Immunohistochemistry for detection of human FOXP3 and human CD45 in mouse organs (gut, liver, lung, and spleen) and human pores and skin grafts and evaluation of slides was carried out as described beforehand [8]. Immunohistochemical localization of CD45 as leukocyte marker and FOXP3 as Treg marker was carried out by gentle microscopy for particular person mice and scored in keeping with a grading scale: 0 (no findings), 1 (minimal), 2 (gentle), 3 (reasonable), 4 (marked) and 5 (extreme).

Statistics

Pattern dimension calculation for mouse experiments was carried out with GPower software program 3.1. 5 mice per group had been wanted to get an impact dimension of two between management PBMC- and CAR-Treg-treated teams with a check energy of 0.89. Statistical analyses had been performed utilizing GraphPad Prism 8.4.3. Info on pattern dimension, replicates, variables, and statistical significance testing is supplied within the determine legends. One-way peculiar evaluation of variance (ANOVA), 2-way ANOVA (with Tukey’s or Dunnett’s a number of comparability check), Kruskal–Wallis a number of comparability check with Dunn’s post-test, or Holm-Sidak technique following a number of t-test, had been carried out as applicable to evaluate statistical significance. P-values < 0.05 had been thought of statistically important. P-values in figures are offered as *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

Facebook
Twitter
Pinterest
WhatsApp
RELATED ARTICLES

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Most Popular

Recent Comments